Spaces:
Runtime error
Runtime error
File size: 8,488 Bytes
90b1023 8bf3bbe 90b1023 a0cb03b 90b1023 a0cb03b 90b1023 a0cb03b 1770751 a0cb03b cdc5652 a0cb03b cdc5652 90b1023 a0cb03b cdc5652 a0cb03b cdc5652 a0cb03b 90b1023 a0cb03b 23e3a2e a0cb03b 90b1023 a0cb03b 90b1023 a0cb03b cdc5652 a0cb03b 1770751 a0cb03b 1770751 a0cb03b 1770751 a0cb03b 1770751 a0cb03b 0dcaf15 a0cb03b 23e3a2e 90b1023 e22db07 a0cb03b 90b1023 a0cb03b e22db07 a0cb03b 90b1023 cdc5652 a0cb03b cdc5652 90b1023 cdc5652 a0cb03b cdc5652 90b1023 23e3a2e a0cb03b 90b1023 a0cb03b 90b1023 a0cb03b 90b1023 cdc5652 a0cb03b 90b1023 a0cb03b e22db07 a0cb03b 90b1023 a0cb03b 1770751 a0cb03b e22db07 a0cb03b 90b1023 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 | # --- Imports ---
import gradio as gr
import spaces
from transformers import pipeline
# --- Load Model ---
pipe = pipeline(model="InstaDeepAI/ChatNT", trust_remote_code=True)
# --- Logs ---
log_file = "logs.txt"
def log_message(message: str):
with open(log_file, "a") as log:
log.write(f"{message}\n")
# --- Utilities ---
def read_dna_sequence(dna_text, fasta_file):
"""
This function reads the DNA sequence, either from the text field or from the FASTA file,
and it checks the format.
It might return an error if the format of the FASTA file is incorrect.
Returns:
dna_sequence: str
warning: str if any
error: str if any
"""
dna_sequence = ""
warning = ""
error = ""
# Pasted text
if dna_text and dna_text.strip():
dna_sequence = dna_text.strip().replace("\n", "")
# Uploaded FASTA overrides text
if fasta_file is not None:
if dna_sequence:
warning = "Warning: Both pasted DNA and FASTA file provided. Using file only."
try:
with open(fasta_file.name, "r") as f:
content = f.read()
if not content.startswith(">"):
error = "Invalid FASTA: must start with '>' header line."
return "", warning, error
sequence = ""
for line in content.splitlines():
if not line or line.startswith(">"):
continue
sequence += line.strip()
dna_sequence = sequence
except Exception:
error = "Could not read the FASTA file."
if dna_sequence and not dna_sequence.isupper():
dna_sequence = dna_sequence.upper()
warning += "\nNote: DNA sequence was converted to uppercase."
return dna_sequence, warning.strip(), error
def validate_inputs(dna_sequence: str, custom_question: str):
"""
This function is used to
Args:
dna_sequence (str): DNA sequence used by the user.
Note: It might be empty ("")
custom_question (str): Question of the user (in english).
Returns:
valid: bool
Whether the input is valid (correct number of <DNA> tokens, etc)
error: str
Error message if necessary
"""
placeholders = custom_question.count("<DNA>")
if not custom_question.strip():
return False, "Please provide a question."
if dna_sequence and placeholders == 0:
log_message("Error: DNA sequence provided but no <DNA> token.")
return False, "Your question must contain the <DNA> token if you provide a DNA sequence."
if not dna_sequence and placeholders == 1:
log_message("Error: <DNA> token but no sequence.")
return False, "You must provide a DNA sequence if you use the <DNA> token."
if placeholders > 1:
return False, "Only one <DNA> token is allowed."
return True, ""
# --- Main Inference ---
@spaces.GPU
def run_chatnt(dna_text, fasta_file, custom_question):
feedback_msgs = []
dna_sequence, warning, fasta_error = read_dna_sequence(dna_text, fasta_file)
if fasta_error:
return "", fasta_error
is_valid, validation_error = validate_inputs(dna_sequence, custom_question)
if not is_valid:
return "", validation_error
final_prompt = custom_question
inputs = {
"english_sequence": final_prompt,
"dna_sequences": [dna_sequence] if dna_sequence else []
}
output = pipe(inputs=inputs)
result = output
if warning:
feedback_msgs.append(warning)
return result, "\n".join(feedback_msgs)
# --- Gradio Interface ---
css = """
.gradio-container { font-family: sans-serif; }
.gr-button { color: white; border-color: black; background: black; }
footer { display: none !important; }
"""
example_dna = "TCTCAGGCCCACACTCCCCCGGGGAGGACCGGTTTGAAGCGCAGCCTCCTACGACTCGATGCGCAAATACTGTACTCGGAGTCCCCGGGGATGACACGTCACGGTCCAGTCAAGGCCGGTAGGTGACATGTTCGTCTCCCGAGCCGGACATGCGGATTAACGTTTCATAGTTCCCGAACTTCCCTTGAGGCGGTAATCCCCAATCGTGAAGAGGGTCTCACCCGTCGCTTGCTTACTTTGCACGTACCTGTACGAGCGTGAATGGGACTACAGCCCGTGTTGACGGCTTACTGGATCCCTTGTAATTAATCGTCGAGAGATGAGCGATGCAATGCGGCCAGACATGACTACAATTCTGTTGTAGACTCTGTGCTAAGGCCATCTTTCTAGATGAACCAGCATGGTTGAGATTCGCCCGGCTTAGCGAGGTACTGGCATGCACGCGGCCCACATACCGGCCATTGGGGGAAAATTTTATTAAACTCTCAAGGTCGGAATTCTGTCTATCAGAC"
example_question = "Does this sequence <DNA> contain a donor splice site?"
with gr.Blocks(css=css) as demo:
gr.Markdown(
"""
# 🧬 ChatNT: A Multimodal Conversational Agent for DNA, RNA and Protein Tasks
[ChatNT](https://www.nature.com/articles/s42256-025-01047-1) is the first multimodal conversational agent designed with a deep understanding of biological sequences (DNA, RNA, proteins). It enables users — even those with no coding background — to interact with biological data through natural language and it generalizes across multiple biological tasks and modalities
This Hugging Face Space is powered by a [ZeroGPU](https://huggingface.co/docs/hub/en/spaces-zerogpu), which is free but **limited to 5 minutes per day per user**.
"""
)
with gr.Row():
with gr.Column(scale=1):
dna_text = gr.Textbox(
label="Paste your DNA sequence",
placeholder="ATGCATGC...",
lines=4
)
fasta_file = gr.File(
label="Or upload your FASTA file",
file_types=[".fasta", ".fa", ".txt"],
height=50
)
custom_question = gr.Textbox(
label="English Question",
placeholder="Does this sequence <DNA> contain a donor splice site?"
)
use_example = gr.Button("Use Example")
submit_btn = gr.Button("Run Query", variant="primary")
with gr.Column(scale=1):
output = gr.Textbox(
label="Model Answer",
lines=12
)
error_box = gr.Textbox(
label="Execution Feedback",
lines=4
)
submit_btn.click(
run_chatnt,
inputs=[dna_text, fasta_file, custom_question],
outputs=[output, error_box],
)
use_example.click(
lambda: (example_dna, None, example_question),
inputs=[],
outputs=[dna_text, fasta_file, custom_question]
)
with gr.Row():
with gr.Column(scale=3):
gr.Markdown(
"""
You must use **exactly one `<DNA>` token** if you want the model to see your sequence.
It is also possible to use the model without any DNA sequence (in this case, the `<DNA>` token must not be present in the question).
You can either paste a sequence or upload a FASTA file.
---
### ✅ Good queries
- "Does this sequence `<DNA>` contain a donor splice site?"
- "Is it possible for you to identify whether there's a substantial presence of H3 histone protein occupancy in the nucleotide sequence `<DNA>` in yeast?"
- "Determine the degradation rate of the mouse RNA sequence `<DNA>` within the -5 to 5 range."
### ❌ What will not work properly
- "What is the length of this sequence `<DNA>`?"
- "Replace the all 'A' nucleotides by 'G' in this sequence `<DNA>`.
For more examples, you can refer to the [training dataset](https://huggingface.co/datasets/InstaDeepAI/ChatNT_training_data).
"""
)
with gr.Column(scale=1):
gr.Image("https://media.springernature.com/w440/springer-static/cover-hires/journal/42256/7/6")
gr.Markdown("""
### 📚 Citation
If you use **ChatNT**, please cite:
```bibtex
@article{deAlmeida2025,
title = {A multimodal conversational agent for DNA, RNA and protein tasks},
author = {de Almeida, Bernardo P. and Richard, Guillaume and Dalla-Torre, Hugo and Blum, Christopher and Hexemer, Lorenz and Pandey, Priyanka and Laurent, Stefan and Rajesh, Chandana and Lopez, Marie and Laterre, Alexandre and Lang, Maren and Şahin, Uğur and Beguir, Karim and Pierrot, Thomas},
journal = {Nature Machine Intelligence},
year = {2025},
volume = {7},
number = {6},
pages = {928--941},
doi = {10.1038/s42256-025-01047-1},
url = {https://doi.org/10.1038/s42256-025-01047-1},
issn = {2522-5839}
}
```
""",
show_copy_button=True
)
if __name__ == "__main__":
demo.queue()
demo.launch(debug=True, show_error=True) |